Practical 7¶
In this practical we will keep practicing with functions and will see how to get input from the command line.
Functions¶
Reminder. The basic definition of a function is:
def function_name(input) :
#code implementing the function
...
...
return return_value
Functions are defined with the def keyword that proceeds the function_name and then a list of parameters is passed in the brackets. A colon : is used to end the line holding the definition of the function. The code implementing the function is specified by using indentation. A function might or might not return a value. In the first case a return statement is used.
Getting input from the command line¶
To call a program my_python_program.py from command line, you just
have to open a terminal (in Linux) or the command prompt (in Windows)
and, assuming that python is present in the path, you can cd into
the folder containing your python program, (eg.
cd C:\python\my_exercises\) and just type in
python3 my_python_program.py or python my_python_program.py In
case of arguments to be passed by command line, one has to put them
after the specification of the program name (eg.
python my_python_program.py parm1 param2 param3).
Python provides the module sys to interact with the interpreter. In particular, sys.argv is a list representing all the arguments passed to the python script from the command line.
Consider the following code:
In [2]:
import sys
"""Test input from command line in systest.py"""
if(len(sys.argv) != 4):
print("Dear user, I was expecting 3 params. You gave me ",len(sys.argv)-1)
exit(1)
else:
for i in range(0,len(sys.argv)):
print("Param {}:{} ({})".format(i,sys.argv[i],type(sys.argv[i])))
Dear user, I was expecting 3 params. You gave me 2
Invoking the systest.py script from command line with the command
python3 exercises/systest.py 1st_param 2nd 3 will return:
Param 0: exercises/systest.py (<class 'str'>)
Param 1: 1st_param (<class 'str'>)
Param 2: 2nd (<class 'str'>)
Param 3: 3 (<class 'str'>)
Invoking the systest.py script from command line with the command
python3 exercises/systest.py 1st_param will return:
Dear user, I was expecting three parameters. You gave me 1
Note that the parameter at index 0, sys.argv[0] holds the name of
the script, and that all parameters are actually strings (and
therefore need to be cast to numbers if we want to do mathematical
operations on them).
Example: Write a script that takes two integers in input, i1 and i2, and computes the sum, difference, multiplication and division on them.
In [ ]:
import sys
"""Maths example with input from command line"""
if(len(sys.argv) != 3):
print("Dear user, I was expecting 2 params. You gave me ",len(sys.argv)-1)
exit(1)
else:
i1 = int(sys.argv[1])
i2 = int(sys.argv[2])
print("{} + {} = {}".format(i1,i2, i1 + i2))
print("{} - {} = {}".format(i1,i2, i1 - i2))
print("{} * {} = {}".format(i1,i2, i1 * i2))
if(i2 != 0):
print("{} / {} = {}".format(i1,i2, i1 / i2))
else:
print("{} / {} = Infinite".format(i1,i2))
Which, depending on user input, should give something like:
note that we need to check if the values given in input are actually
numbers, otherwise the execution will crash (third example). This is
easy in case of integers (str.isdigit()) but in case of floats it is
more complex and might require Exception handling.
A more flexible and powerful way of getting input from command line
makes use of the Argparse
module.
Argparse¶
Argparse is a command line parsing module which deals with user specified parameters (positional arguments) and optional arguments.
Very briefly, the basic syntax of the Argparse module (for more
information check the official
documentation) is the
following.
- Import the module:
import argparse
- Define a argparse object:
parser = argparse.ArgumentParser(description="This is the description of the program")
note the parameter description that is a string to describe the program;
Add positional arguments:
parser.add_argument("arg_name", type = obj, help = "Description of the parameter)where
arg_nameis the name of the argument (which will be used to retrieve its value). The argument has typeobj(the type will be automatically checked for us) and a description specified in thehelpstring.Add optional arguments:
parser.add_argument("-p", "--optional_arg", type = obj, default = def_val, help = "Description of the parameter)where
-pis a short form of the parameter (and it is optional),--optional_argis the extended name and it requires a value after it is specified,defaultis optional and gives a default value to the parameter. If not specified and no argument is passed, the argument will get the value “None”.Helpis again the description string.Parse the arguments:
args = parser.parse_args()
the parser checks the arguments and stores their values in the
argparseobject that we calledargs.Retrieve and process arguments:
myArgName = args.arg_name myOptArg = args.optional_arg
now variables contain the values specified by the user and we can use them.
Example: Let’s write a program that gets a string (S) and an integer (N) in input and prints the string repeated N times. Three optional parameters are specified: verbosity (-v) to make the software print a more descriptive output, separator (-s) to separate each copy of the string (defaults to ” “) and trailpoints (-p) to add several “.” at the end of the string (defaults to 1).
In [ ]:
import argparse
parser = argparse.ArgumentParser(description="""This script gets a string
and an integer and repeats the string N times""")
parser.add_argument("string", type=str,
help="The string to be repeated")
parser.add_argument("N", type=int,
help="The number of times to repeat the string")
parser.add_argument("-v", "--verbose", action="store_true",
help="increase output verbosity")
parser.add_argument("-p", "--trailpoints", type = int, default = 1,
help="Adds these many trailing points")
parser.add_argument("-s", "--separator", type = str, default = " ",
help="The separator between repeated strings")
args = parser.parse_args()
mySTR = args.string+args.separator
trailP = "." * args.trailpoints
answer = mySTR * args.N
answer = answer[:-len(args.separator)] + trailP #to remove the last separator
if args.verbose:
print("the string {} repeated {} is:".format(args.str, args.N, answer))
else:
print(answer)
Executing the program from command line without parameters gives the message:
Calling it with the -h flag:
With the positional arguments "ciao a tutti" and 3:
With the positional arguments "ciao a tutti" and 3, and with the
optional parameters -s "___" -p 3 -v
Example: Let’s write a program that reads and prints to screen a text file specified by the user. Optionally, the file might be compressed with gzip to save space. The user should be able to read also gzipped files. Hint: use the module gzip which is very similar to the standard file management method (more info here). You can find a text file here textFile.txt and its gzipped version here text.gz:
In [ ]:
import argparse
import gzip
parser = argparse.ArgumentParser(description="""Reads and prints a text file""")
parser.add_argument("filename", type=str, help="The file name")
parser.add_argument("-z", "--gzipped", action="store_true",
help="If set, input file is assumed gzipped")
args = parser.parse_args()
inputFile = args.filename
fh = ""
if(args.gzipped):
fh = gzip.open(inputFile, "rt")
else:
fh = open(inputFile, "r")
for line in fh:
line = line.strip("\n")
print(line)
fh.close()
The output:
Example: Let’s write a program that reads the content of a file and prints to screen some stats like the number of lines, the number of characters and maximum number of characters in one line. Optionally (if flag -v is set) it should print the content of the file. You can find a text file here textFile.txt:
In [ ]:
import argparse
def readText(f):
"""reads the file and returns a list with
each line as separate element"""
myF = open(f, "r")
ret = myF.readlines()
return ret
def computeStats(fileList):
"""returns a tuple (num.lines, num.characters,max_char.line)"""
num_lines = len(fileList)
lines_len = [len(x.replace("\n", "")) for x in fileList]
num_char = sum(lines_len)
max_char = max(lines_len)
return (num_lines, num_char, max_char)
parser = argparse.ArgumentParser(description="Computes file stats")
parser.add_argument("inputFile", type=str, help="The input file")
parser.add_argument(
"-v", "--verbose", action="store_true", help="if set, prints the file content")
args = parser.parse_args()
inFile = args.inputFile
lines = readText(inFile)
stats = computeStats(lines)
if args.verbose:
print("File content:\n{}\n".format("".join(lines)))
print(
"Stats:\nN.lines:{}\nN.chars:{}\nMax. char in line:{}".format(
stats[0], stats[1], stats[2]))
Output with -v flag:
Output without -v flag:
Exercises¶
- Modify the program of Exercise 5 of Practical 6 in order to allow users to specify the input and output files from command line. Then test it with the provided files. The text of the exercise follows:
Write a python program that reads two files. The first is a one column text file (contig_ids.txt) with the identifiers of some contigs that are present in the second file, which is a fasta formatted file (contigs82.fasta). The program will write on a third, fasta formatted file (e.g. filtered_contigs.fasta) only those entries in contigs82.fasta having identifier in contig_ids.txt.
Show/Hide Solution
Cytoscape is a well known tool to perform network analysis. It is well integrated with several online databases housing for example protein-protein interactions like EBI’s IntAct. It is also able to read and write a very simple text file called
.sifto represent interactions between the nodes of a network. Sif formatted files are tab separated (\t) and each line represents a connection between the nodes of the network. For example:node1 interaction1 node2 node1 interaction2 node3 node2 interaction1 node3
represents two types of interactions between node1, node2 and node3. Normally nodes are represented as circles in a network (graph) and interactions as lines (that can be of different kinds) connecting nodes (edges). The following is an extract from the file pka.sif that has been downloaded by Cytoscape from the database IntAct and represents the interactions of the Protein Kinase A (PKA) of E.coli:
P75742 EBI-9168813 P76594 P21513 EBI-888473 P76594 P21513 EBI-15543881 P76594
the first and third columns represent proteins and the second is the interaction joining them. All the values are identifiers from the IntAct database. The cytoscape representation of the full set of interactions is:
Write a python script that reads in the .sif file (pka.sif is here but even better if any .sif file specified in input by the user) and stores the information in one (or more) suitable objects to be able to:
1. Print the interaction that is more present among the nodes;
2. Print the node that is connected to the highest number of
other nodes (no matter if on the left or right of the interaction);
Hint: you can store the information in a dictionary having the interaction as key and a list of tuples (node1,node2) as value. Although redundant, it is convenient to keep a list of unique nodes. Note: This will use more memory but it is acceptable for small examples as it allows to quickly answer the questions.
Optional: check what these ids refer to on the IntAct database.
Show/Hide Solution
- Given a fasta file like contigs82.fasta specified in input by a user, write a python script that counts, for each sequence, the number of times that a DNA or protein string specified in input appears.
If we run something like: python3
find_stringInFasta.py contigs82.fasta TGCTCACAG
the result should print lines like:
TGCTCACAG in MDC052568.000: 1 times
TGCTCACAG in MDC002479.192: 1 times
TGCTCACAG in MDC040033.7: 1 times
Modify the program so that it outputs also the list of all the indexes where the string appears in each sequence in the fasta file. Try to look for the following sequences:
TTTTCCTAGG
TGCTCCGAGCATGTGATAATCATTCCAAGCTCCAT
TAAACAT
GATTACA
Show/Hide Solution
- The Fisher’s dataset regarding Petal and Sepal length and width in csv format can be found here. These are the measurements of the flowers of fifty plants each of the two species Iris setosa and Iris versicolor.
The header of the file is:
Species Number,Species Name,Petal width,Petal length,Sepal length,Sepal width
Write a python script that reads this file in input (feel free to hard-code the filename in the code) and computes the average petal length and width and sepal length and width for each of the three different Iris species. Print them to the screen alongside the number of elements.
Show/Hide Solution